Mysteries

Monday Night Mystery: Crown of Thorns

I’ve been easy on you guys recently. In honor of Labor Day, then, I’m going to make you Labor for tonight’s challenge.

Here are two similarly spiny ants:

Ant A

Ant B

Myrmecos Points will be awarded as follows:

4 points for guessing the genus of Ant A
4 points for guessing the genus of Ant B
2 points for the telling me whether the spines are evolutionarily convergent or synapomorphic (=shared from a common spiny ancestor).

Correct guesses must be supported by character information (for the IDs) or references (for the evolution question).

As usual, the cumulative points winner for the month of September will win their choice of 1) any 8×10-sized print from my photo galleries, or 2) a guest post here at Myrmecos on a safe-for-work topic of their choosing.

Answer to the Monday Night Mystery

As many of you picked, Monday’s mystery weevil was Haplorhynchites aeneus – the sunflower decapitating weevil (or something like that).

Points are awarded as follows:

7 points to Chris Grinter for being the first to pick the species.
3 points to Serena for being the first to pick the genus.
1 point to James Trager for some extra and much-appreciated natural history nerdery.

Right. So this brings us to the end of August (*sigh*). The monthly winner, with 12 points, is FormicidaeFantasy, who edges out second-place Jason C by two.

Congratulations, FF, please contact me at your convenience to claim your loot.

Monday Night Mystery

This insect was photographed on the stem of a yellow composite in an Illinois priarie.

The nose knows, and this little insect appears to have quite a long one. But do you know?

Ten Myrmecos Points (TM) for the first correct guess to genus and species of our mystery insect. Supporting information about identifying characters must be provided to claim points.

As usual, the cumulative points winner for the month of August will win their choice of 1) any 8×10-sized print from my photo galleries, or 2) a guest post here at Myrmecos on a safe-for-work topic of their choosing.

Answer to the Monday Night Mystery

What were those sonorous summer songs?

In spite of being “the toughest MNM yet,” several of you picked the correct answers. Five points each go to Scot for the scissor-grinder cicada Tibicen pruinosa, and to Ted MacRae for the jumping bush cricket Orocharis saltator.

An excellent resource for learning the singing insects of eastern North America is the Songs of Insects site. Lang Elliot and Wil Hershberger have assembled a library of clean recordings paired with sharp photographs- a real treasure for insect enthusiasts.

Monday Night Mystery: The Sounds of Late Summer

Click to listen

At least two insects are audible in the sound clip linked above, recorded just ten minutes ago in my yard in Urbana, Illinois. What are they?

The first correct species name for each insect is worth 5 Myrmecos Points (TM).

As usual, the cumulative points winner for the month of August will win their choice of 1) any 8×10-sized print from my photo galleries, or 2) a guest post here at Myrmecos on a safe-for-work topic of their choosing.

Answer to the Monday Night Mystery

What was that magical mystery DNA?

A ten-point sweep to commentator Formicidae Fantasy, whose rapid series of answers was spot-on:

  1. It’s from Apis dorsata…

  2. And I believe that it determines sex, so that homogeneous individuals will be male.

  3. And apparently males produced this way get eaten before maturity!

That’s exactly right.

Here’s a BBC video of our favorite narrator hanging out (literally) with Apis dorsata:

Monday Night Mystery

For tonight’s challenge we delve into molecular genetics. Here’s a snippet of insect DNA:

ATGAAACGAAATACATCAAGTCATTCGCATCGCGA
TGAGAGATTTAGACAATCACGCAGTGAAGATAGTG

The questions:

1. What species did this come from? (4 points)
2. What happens to an individual whose maternal and paternal chromosomes hold this same allele? (6 points)

As usual, the cumulative points winner for the month of August will win their choice of 1) any 8×10-sized print from my photo galleries, or 2) a guest post here at Myrmecos on a safe-for-work topic of their choosing.

Answer to the Monday Night Mystery

What was that Myrmidon of Mystery?

As so astutely guess by commentator JasonC (who really ought to write a book about how to identify insects on the internet), the ant was Pachycondyla lutea. Ten points, Mr. Jason.

I’m going to award two points to Dave, also, for noting the taxonomic troubles that surround Pachycondyla. Yesterday’s was an especially hard mystery, and those of you who guessed Hypoponera were not far off.

The trouble is that Pachycondyla isn’t a natural grouping of ants. It’s just an arbitrary assemblage of ponerines, the assorted odds and ends left over after the recognition of more distinct genera (like Hypoponera, Leptogenys and Odontomachus). The genus doesn’t have a distinct look- you just kind of have to know the species. Pachycondyla lutea is a relatively common- if inconspicuous- Australian ant with a unique combination of eye size, body shape, and a distinct set of long hairs on the clypeus.

Monday Night Mystery

There’s nothing like a good old-fashioned Name That Ant. Tonight’s mystery hails from Australia:

Who am I?

Five points for genus, five more for species. Points will only be awarded for the first correct guess- including supporting information– in each category.

As usual, the cumulative points winner for the month of August will win their choice of 1) any 8×10-sized print from my photo galleries, or 2) a guest post here at Myrmecos on a safe-for-work topic of their choosing.

Answer to the Monday Night Mystery

Who was that beguiling blond with the blue dot?

Commentator EntoWannaBe (EntoWanna-Bee?) picks up 8 points for correctly guessing that she’s Cordovan and that the color of the beekeeper’s mark on her back indicates her age. The present insect was born in 2010: this year. She’s a queen from one of the student hives in the University of Illinois Beekeeping class.

The Cordovan trait is a single mutation that knocks out the black color in the bee cuticle. It’s a recessive trait, so visibly Cordovan queens are homozygous. Since this queen mated with mostly wild-type drones, most of her daughters retain the wild-type stripes. It’s a handy marker for beekeepers, as Cordovan coloration doesn’t confer any obviously negative effects on the bees and it allows for easy visual tracking of individuals.

Two points each go to Linda Bui, Joshua King, Megan M, and FormicidaeFantasy for bee-ing punny in the comments. Ha.

Speaking of, here’s a bee song to stick in your head: