Category Archives: Mysteries

Answer to the Monday Mystery: Camponotus depressus

by
ads

Camponotus depressus. Image courtesy April Nobile/antweb.org, and shared under a Creative Commons CC-BY-SA 3.0 license. 

What was the oddly flat ant?

KMS picked up all ten points for naming Camponotus depressus, a bamboo-nesting species found in Amazonia south to Paraguay. Little research has been done on this unusual species. But, check out Davidson et al 2006:

Davidson, W.; Arias, Ja; Mann, J., 2006: An experimental study of bamboo ants in western Amazonia. Insectes Sociaux ruary; 53(1): 108-114

 

 

Monday Night Mystery: The Curious Case Of the Two-Dimensional Ant

by

Many years ago I lived on the fringes of the great Mbaracayú forest in eastern Paraguay. One day, while walking along a stream bank in the forest, I saw one of the weirdest ants I’ve ever laid eyes on. It was big, black, and looked like it could be folded up flat and tucked into a book.

flat mystery

Your questions are:

1. What is this two-dimensional ant? (to species, 5 points).
2. Where does it make its nests? (5 points).

Points will be awarded to the first correct guess for each question, and the cumulative points winner across all mysteries for the month of March will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

 

Answer to the Monday Mystery

by
ac

Cimex lectularius, the common bedbug, getting a taste of me.

 

What were those grapelike globules? All ten points go to Guillaume D for his guess of a bed bug’s compound eye. Guillaume accumulated enough points earlier in the month to lock in a win for February. Congrats, Guillaume, email me for your loot!

The SEM image in the mystery post was taken from the CDC public domain image library, a great source of open images for blogging and teaching.

 

Monday Night Mystery: The Grapes Of Wrath

by
mystery15

public domain image

 

Tonight’s challenge is a bunch of grapes something small scanned in an electron microscope. To win points, be the first to answer the following questions correctly.

1. What is the bubbly structure at the center of the image? (2 points)
2. What is the mystery animal’s genus & species? (6 points)
3. Where are you most likely to find this animal? (2 points)
A. Chicago
B. The Amazon
C. The Everglades
D. Death Valley

The cumulative points winner across all mysteries for the month of February will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

 

Answer to the Monday Mystery

by
Pseudomyrmex gracilis 4

Pseudomyrmex gracilis, Archbold Biological Station, Florida

 

What was the correct sequence/species match?

1 – D; Wasmannia auropunctata
2 – C; Pseudomyrmex gracilis
3 – A; Formica moki
4 – B; Proceratium avium

Points are split 5 each between Sean McCann, who was first to correctly guess two of the answers, and Tonya Severson, who got them all correct. Nice work. This was one of the more difficult challenges.

 

Monday Night Mystery: An Eye For Ant Genetics

by

Here are four fragments of mitochondrial DNA:

1. GGATTAATTGGATCCTCTATGAGTATAATTATCCGATTAGAACTAGGCTCATG
2. ATCATCAATAAGAATAATTATTCGAATTGAATTAGGATCCTGTGGATCCATTA
3. TATAAGATTTTGACTCTTACCACCTTCCATTACTCTTTTACTTTTAAGAAATTT
4. TCAATAAGAATATTAATTCGTTTAGAACTAGGAACATGTAATTCCATTATCAAT

And here are the eyes of four ants:

mystery100

To win all 10 points for tonight’s mystery, be the first to correctly pair each sequence with its eye.

The cumulative points winner across all mysteries for the month of February will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

Answers to the Monday Mysteries

by
Papilio1

Papilio glaucus

 

I’m economizing this month by doubling up on mystery answers. Yesterday’s scaly challenge depicted the hindwing of a tiger swallowtail, Papilio glaucus, Papilionidae, and this species is least likely to be found on carrots.

6 points to Guillaume D, and 2 to MrILoveTheAnts, for being the first to correctly pick the taxonomy and the host plant questions, respectively.

For the preceding week’s Hitchhiking Conundrum, the correct answers were: Nicrophorus, the mites were Poecilochirus, the off-frame insect was a calliphorid fly whose larvae are sometimes eaten by the hitchhiking mites.

Rodolfo swept all ten points within minutes. Impressive! One consolation point goes to Ben Coulter, who found the original, uncropped image online and identified the fly as Calliphora.

 

Nicrophorus1

 

 

 

 

Monday Night Mystery: The Scales of Just This

by

mystery12

These colorful scales belong to a common North American insect. Your mission, should you choose to accept it, is to answer the following:

1. What part of the insect is shown? (2 points)
2. To what family (1 point), genus (2 points), and species (3 points) does this insect belong?
3. Which of the following plants is least likely to host the immature form of this insect? Carrot, Tulip Tree, Oak Tree, Black Cherry, Magnolia (2 points).

The cumulative points winner across all mysteries for the month of February will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

 

Monday Night Mystery: The Case Of The Eight-Legged Hitchhikers

by

Mystery150

 

After a long hiatus, the Monday Mystery returns!

1. What is the genus of the big, colorful animal? (3 points)
2. What is the genus of its hitchhikers? (3 points)
3. This image is heavily cropped to better show the little hitchhikers, but the original exposure also captured a third arthropod. What was it (2 points), and how does it interact with the two species pictured here (2 points)?

The cumulative points winner across all mysteries for the month of February will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

Did LiveLeak Just Leak An Unknown Ant Behavior?

by

Those corners of the internet prone to viral outbreaks are abuzz today with an intriguing ant video:

Is it real? Yes.

The quality isn’t great, but the clip appears to show an Asian Leptogenys daisy-chaining their bodies in parallel lines to haul away a large millipede. I have spent the morning searching the technical literature for mention of this unusual behavior, and am coming up empty. Some Leptogenys species, including L. diminuta, L. nitida, and L. processionalis, are known to forage in groups and transport prey “cooperatively” (source, source). What is meant by “cooperative” is often vague. (For more, see this excellent recent review of cooperative transport by Helen McCreery).  Yet I didn’t find any explicit description of workers linking up, mandible to abdomen, to pull together.

Is ponerine daisy-chaining an unknown behavior? Possibly. It is also possible my search skills aren’t up to the task. If you know of a description of it, please drop a note in the comments. I am not the only one interested, either:

couzin

I did, however, happen across a higher quality video from a Cambodian beekeeper:

I presume the swelling music helps motivate the ants to pull harder. But, I digress.

Steve Shattuck took a photograph recently in Borneo capturing a variation on this behavior, with workers forming a chain by biting the legs of a preceding ant.

Leptogenys1

Again, I don’t think the behavior has been formally described beyond this smattering of visual media.

Regardless of documentation, daisy chaining raises some definitely unanswered questions and will make a fine Ph.D. thesis for some lucky student. How do ants organize themselves in chains? What cues do they use? How do they know to let go? Is chaining employed only for particular sizes or species of prey? How does the behavior effect overall foraging efficiency? What are the evolutionary precursors to chaining? And, do these ants have any other tricks up their coxae?

 ***Update 8/30/2014 – 

In the comments, Roberto Keller suggested that the eminent ponerophile Christian Peeters might know something. And indeed, Christian emails in with the following:

I observed this fascinating behaviour in Cambodia 4 years ago. Stéphane De Greef was with me and some of his photos are attached.

The behaviour was very stereotyped: mandibles grab preceding ant’s gaster (between first and second segment).

Seiki Yamane identified it as Leptogenys sp. 47, closely related to L. chalybaea described from Borneo by Emery (but stronger sculpture especially on gastral tergites).

The millipedes were 130mm long, identified as order Spirostreptida (Diplopoda). Ant is 16mm long.

Back then I reviewed the literature and found no other record of chain behaviour in Ponerinae. No record of millipede predation in Leptogenys.  Specialized hunting on millipedes is restricted to Thaumatomyrmex, Probolomyrmex and Gnamptogenys, but these are solitary hunters on a very different kind of millipedes (polyxenids).

I started writing a ms on this behaviour (formation of chains in ants through a self-assembling behaviour) but sadly I have not been able to get further observations. It seems to happen at certain times of the year only.

By an amazing coincidence, two days ago I finished fieldwork in northern Thailand and came across the same Leptogenys species. There were cleaned out ring segments of big millipedes outside entrances. Unfortunately I did not observe any raids.

Image by Stéphane De Greef, used with permission.

Image by Stéphane De Greef, used with permission.


postscript: The virality of the video also illustrates both the good and the bad about the internet. The good, of course, is that this fascinating ant behavior found its way in front of scientists who otherwise might not have seen it. On the other hand, the viral nature of the video means that actual person who filmed it is drowned out among the hundreds of uncredited, unsourced copies. Securing the information about where and when the video was taken, and verifying the species, is going to be difficult. This is one reason why crediting sources online is important. Lose the credit, lose the data.