Ants

Here’s Looking At You, Ant

eye

The compound eye of many ants, including a Camponotus I imaged this morning on the new focus-stacking rig, has two colors of ommatidia. Most are black, but the peripheral facets are lighter. I’ve seen this for years but had no idea why this might be the case.

A quick search on Google scholar suggests an orientation function related to light polarization:

abstract

Can anyone who knows more about insect vision than me weigh in? I’m genuinely curious.

 

Camponotus sayi
Camponotus sayi, worker from Austin, Texas.

 

Update: Micheal Bok has the answer!

Monday Night Mystery: An Eye For Ant Genetics

Here are four fragments of mitochondrial DNA:

1. GGATTAATTGGATCCTCTATGAGTATAATTATCCGATTAGAACTAGGCTCATG
2. ATCATCAATAAGAATAATTATTCGAATTGAATTAGGATCCTGTGGATCCATTA
3. TATAAGATTTTGACTCTTACCACCTTCCATTACTCTTTTACTTTTAAGAAATTT
4. TCAATAAGAATATTAATTCGTTTAGAACTAGGAACATGTAATTCCATTATCAAT

And here are the eyes of four ants:

mystery100

To win all 10 points for tonight’s mystery, be the first to correctly pair each sequence with its eye.

The cumulative points winner across all mysteries for the month of February will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

Another Reason Why Ants Don’t Have Traffic Jams

EciBur13j

There’s a story going around about how ants never have traffic jams. It’s a fine bit of science about how ants adjust their speed and don’t overtake each other, leading to smooth, fast speeds down the formicid freeway.

But I wouldn’t recommend humans adopt ant traffic management strategies. The physics of being small gives ants an enormous advantage.

Ant are tiny compared to us, and collisions at their size involve vanishingly small forces (remember F = [m][a]?), even at high speeds. Ants can cruise along with nothing to lose; the cost of veering into an errant stone or oncoming traffic is a slight bump, barely felt. They pick up and move along.

Cars? Not so much. You can imagine how much quicker rush hour traffic would move if drivers were immune to accidents, fearless and fast. People would drive like ants.

Ant Course 2015: Arizona

landscape1
Arizona’s Chiricahua mountains, site of the Arizona ant course.

Unless you’ve been living under a rock (actually, not a bad place for a myrmecologist), you have heard of Cal Academy’s famous “Ant Course”. This week-long intensive workshop on the taxonomy of our favorite animals has been running once per year for over 10 years now, and nearly everyone of a certain age who works in myrmecology has taken it, taught it, or both.

This summer’s course returns to its roots in southeastern Arizona. Space is limited and the course nearly always sells out, so apply early and apply hard. Click on the course flier below for more details, or visit the website.

AZflyer2

 

ANT COURSE 2015 August 6-16, Southwestern Research Station (SWRS), Portal, AZ, USA More info: http://www.calacademy.org/scientists/ant-course

DEADLINE FOR APPLICATION: April 1, 2015. Apply Here: https://docs.google.com/forms/d/1Z5Fu8DHxqW5EGFkiLbxi4mHWpnc2Tn0vzmN5ctvXj1g/viewform?c=0&w=1

ANT COURSE will be taught at the Southwestern Research Station (SWRS) in Portal Arizona (http://research.amnh.org/swrs/). The Station is centered amid the richest ant fauna in North America.

PARTICIPANT ACCEPTANCE CRITERIA. – ANT COURSE is open to all interested individuals. Priority will be given to those students for whom the course will have a significant impact on their research with ants. An entomological background is not required. We aim to include students with a diverse interest in biology, including ant systematics, ecology, behavioral biology, genetics, and conservation. The high instructor to student ratio will allow students to receive individual attention. ANT COURSE is presented in English and limited to 30 participants.

COSTS. – Tuition for the 10-day COURSE is $475 for current students and $675 for non-students (including postdocs). In addition, the Southwestern Research Station (SWRS) fee for this period, covering dormitory room and board, is $670. Transportation costs between home and Tucson (air) or SWRS (auto) are to be borne by all participants.

SPONSORS. –California Academy of Sciences and Museum of Comparative Zoology.

2015 INSTRUCTORS : Brian Fisher (Coordinator), California Academy of Sciences; Stefan Cover, Museum of Comparative Zoology; Flavia Esteves, California Academy of Sciences; Bob Johnson, Arizona State University, Tempe; Josh King, University of Central Florida; John LaPolla, Towson University; Jack Longino, University of Utah; Corrie Moreau, Field Museum of Natural History; Scott Powell, George Washington University; Andrew Suarez, University of Illinois; James Trager, Shaw Nature Reserve; Walter Tschinkel Florida State University Tallahassee; Phil Ward, University of California Davis; Special Guests: Raymond Mendez, Howard Topoff.

How To Lie With Pest Control Marketing

Few major pest control companies are as awful in their marketing as Terminix. Consider:

fearmongering

[2011 advertisement for Terminix]

The message is clear: Ants give you diseases, and our company can get rid of them for you.

True?

No.

Let’s be clear about the scare term “carrier”. Terminix would like us to think ants are carriers in the epidemiological sense- like an infected Ebola patient boarding a plane. But that’s a semantic sleight of hand.

The research on the topic of ant-borne diseases is rather more mild. Ants are only “carriers” in that they can physically transport bacteria found in the environment. That’s not surprising. Most things transport bacteria. Your shoes, for example, are excellent carriers of strep, sensu Terminix. Your own hands are even more effective.

Merely carrying bacteria, which everything does anyway, is a different matter than being effective at causing disease. And the evidence that ants are actually dangerous as infectious agents, rather than just theoretically so, is so weak that there are precisely zero known cases where an ant has ever infected a person with strep, staph, or salmonella.

Antweb’s AntBlog explains:

 …if an ant walks through an area densely populated with infectious bacteria, they track it along in quantities large enough to show up in a petri dish.

The good news: Petri dishes don’t have immune systems. The quantities of bacteria ants transport and slough off as they saunter across your counter tops will probably be small compared to the infectious dose for healthy humans. The quantities of bacteria that remain on the ants’ feet after taking the thousands of little ant-steps between a source of infection and your table would presumably knock off the vast majority of the bacteria, leaving too few to constitute an infectious dose.

So what I’m trying to say is: thought it is theoretically possible for ants to transmit infectious bacteria to humans, as far as I’m aware (other members of this blog, please speak up if you know better!) there are no records of ants being definitively implicated in someone catching a disease. As best as I can tell, all of the articles that reference ants’ potential to be vectors for infectious bacteria are based upon laboratory studies in which nothing besides some agar in a petri dish got sick.

Absent evidence of any real health threat, Terminix is just trying to scare you out of your money.

 

The Ever-Present Azteca

Azteca sp.

Anyone keeping an eye out for queen ants in the New World tropics will notice at least one pattern: the constant presence of winged Azteca. All year round, in all forested habitats, there are always hopeful young Azteca queens.

Azteca colonies are typically massive, holding large and tightly-contested treetop territories. Colonies produce a steady stream of flighted reproductives throughout the season, essentially saturating the environment with propagules should a rare patch of unclaimed canopy territory open. This queen came to a light trap in Armenia, Belize.

An Evolutionary Transition, In Vivo

Among the most dazzling products of insect evolution are leafcutter ants, which cultivate an edible fungus on a compost of fresh vegetation. The ants’ digestive chemistry is so simplified that they can only eat the fungus that grows in the underground gardens.

The leafcutter/fungus system is complex enough to seem highly improbable, and indeed, it appears to have evolved only once in the 130 million year history of ants. How could such a complex system appear?

The system did not spring forth fully-formed, of course. I was reminded of the gradual evolutionary transition on our recent BugShot course in Belize, when I happened across Trachymyrmex intermedius.

Trachymyrmex intermedius

 

Contrary to appearances, T. intermedius is not a leafcutter ant.

At least, not technically. True leafcutters belong only to the genera Atta and AcromyrmexTrachymyrmex is instead the sprawling, paraphyletic genus from which the leafcutters arose. These ants also farm fungus, but they typically use dead vegetation, caterpillar frass, and other bits of detritus. Like so:

argentina1

Green vegetation is not the usual fare for Trachymyrmex, but T. intermedius and several others do take it on occasion. Seeing a few of these small ants trundling off with a harvest more fit for their larger cousins was just a reminder that animal behavior is naturally variable, and that variation is what allows the evolutionary process to explore new paths.

Little ant, big thoughts.