Category Archives: Ants

Dolichoderus, at last

by

One of the more common ants in eastern North America is, ostensibly, Dolichoderus. I’ve read that, while restricted to particular habitat types, within those bogs and pine forests they are supposed to be abundant. In theory.

Yet in my entire decades-long career as an ant guy, I have never once seen them alive in North America. Anywhere. It got to the point where I was embarassed to admit such a glaring failure.

Anyway. I broke down and finally begged Ant Guru James Trager to send me a few live workers, and James kindly took pity on me. Herewith, at last, photographs of our North American Dolichoderus:

Dolichoderus mariae – Peninsula State Park, Wisconsin, USA.

A grooming Dolichoderus plagiatus worker shows the protruding propodeum that is diagnostic for the North American species of this genus. Baileys Harbor Beach, Wisconsin, USA.

 

Dolichoderus plagiatus – Baileys Harbor Beach, Wisconsin, USA.

Introducing Tetramorium immigrans: a better name for the long-established pavement ant

by

No longer fighting over a name.

Meet Tetramorium immigrans. 

I have never been more pleased to report a taxonomic name change than this one. Long called “Tetramorium caespitum”, then “Tetramorium species E” once it became clear the Eurasian T. caespitum was a complex of cryptic forms, the pavement ant has spread across the world and is now among most common urban ants in North America. After decades of confusion, Herbert Wagner has published a fine monograph on the taxonomy of the species complex. Among Wagner’s many discoveries was that Santschi’s 1927 “immigrans” was valid for this world-traveller. An apt change, and a fine resolution of a long-standing problem.


source:

How Should Taxonomists Name Your Favorite Ants?

by
Are these two Temnothorax, or one Temnothorax and one Protomognathus?

Are these two Temnothorax species, or one Temnothorax and one Protomognathus?

Last year, a team of Antweb-affiliated myrmecologists published an evolutionary study concluding, among many results, that a slate of socially parasitic genera had evolved from within their host genera. The names of parasitic genera were subsequently sunk. Inclusion of derived groups in their parent genera has been standard practice for decades as a way to keep names consistent with ancestry.

But a number of myrmecologists do not approve of their favorite ants losing their names, and struck back with a strongly worded opinion in Insectes Sociaux this week:

We contend that banning all paraphyletic groups while simultaneously executing binominal Linnaean nomenclature results in a taxonomy going off the rails.

The dissenting authors make a lengthy argument about information content, evolution, and practicality, but the logic distills to, “the sunk genera look different, and we feel it more useful that the difference is reflected in a unique name.” If this argument looks familiar, it is the same case put forth by Ernst Mayr’s “Evolutionary Taxonomy” school in the 1960s and 70s. This was not a winning argument. Most biologists found disagreements about trait differences subjective compared to the relatively clarity of ancestry, and taxonomists today generally agree that recognizing paraphyletic groups is more confusing than the alternatives.

I have little personal experience with the genera in question. From my perspective as an outsider, I had to look up Epimyrma in Bolton’s catalogue to figure out what kind of an ant it was. Formicine? Myrmicine? Had I known it was basically a parasitic Temnothorax, I’d have been that much ahead of the game. Monophyly is information; paraphyly less so. But utility is a question of perspective and context, I suppose, and I can empathize with those who regularly work with these ants. Treating these distinct species as congeners may be as awkward as attending a party where everyone is named Jayden.

Still, given the volumes of vituperative ink spilled a half-century ago in the cladism wars, and the weight of the pro-monophyly consensus among all biologists, I suspect this renegade group of ant scientists will be fighting an uphill battle.

Disclosure: I eclosed as a myrmecologist from Phil Ward’s lab, so of course I am not without my allegiances.


Sources: Seifert, B. et al 2016. Banning paraphylies and executing Linnaean taxonomy is discordant and reduces the evolutionary and semantic information content of biological nomenclature. Insectes Sociaux doi: 10.1007/s00040-016-0467-1

Ward, P.S. et al 2015. The evolution of myrmicine ants: phylogeny and biogeography of a hyperdiverse ant clade (Hymenoptera: Formicidae). Systematic Entomology, 40: 61–81. doi: 10.1111/syen.12090

The Ant Daisy Chain, Described

by

You may remember a recent viral video showing an undescribed predatory ant behavior. It turned out that myrmecologists Christian Peeters and Stéphane de Greef had observed these ants in the field, but they’d not assembled enough data to publish, leaving us all in the dark about how the ants coordinated the amazing millipede-hauling chains.

With a bright internet spotlight on the behavior, Christian and Stéphane returned to the project and have just published a detailed description in Insectes Sociaux. The video alone is worth a thousand words:

 


source: Peeters C, De Greef S. 2015. Predation on large millipedes and self-assembling chains in Leptogenys ants from Cambodia. Insectes Sociaux doi: 10.1007/s00040-015-0426-2

What Does A Bullet Ant Sting Feel Like?

by

I was stung by a bullet ant last week in Costa Rica. On purpose.

Paraponera clavata

Ow.

 

How did it feel?

Bearable. Given this species’ fearsome reputation, I was expecting worse. It certainly hurt, though.

It wasn’t just the initial sear from the sting’s penetration, imparting all the sharpness one would anticipate from a relatively large hymenopteran, but the way the pain sank beneath the skin.

The bullet ant has a reputation for feeling like a firearm wound. Having never been shot, I can’t make much of the comparison. I imagine an actual shooting would be far more traumatic, but all the same I understand where the name comes from. A Paraponera sting feels more profound than the average insect sting. Like tissue or bone damage, it is a deep throbbing ache that crescendos over several hours. Unlike a honey bee sting, whose sharpness gives way quickly to a dull itch, the bullet ant’s sting is the gift that keeps on giving. Less a gunshot, I suppose, than the lasting pain following a solid crowbar to the arm. Although bearable, mine still ached when I went to bed 8 hours later. All pain was gone in the morning.

We tend not to make much of where on the body we’re stung, but stings are like real estate. Location, location, location. The forearm is a relatively mild substrate, a safe place to experiment with stings. I was once zinged on the tip of the nose by a common honey bee. Holy bejeezus. I’ll take twelve bullet ants to the arm before I wish to relive that one.

(Special thanks to Andrés Rojas and Erica Parra for planning the session and wrangling the ants! For more gruesome bullet ant entertainment science, see them and others getting zinged at StingFest 2015).

 

What Are “Indian Harvester Ants?”

by
 This is an image of the entrance to the nest of a species of Indian Harvester Ant. This was spotted in the hills approximately 30 km North-West of Pune, Maharashtra, India. CC BY-SA 3.0

A nest of an Indian Harvester Ant, approximately 30 km North-West of Pune, Maharashtra, India. Image by “Rushil”, shared under a CC BY-SA 3.0 license.

On the Indian subcontinent there is a species of ant with a distinct nest entrance flanked by a raised series of concentric clay rings, as though to prevent flooding. The ant seems reasonably common- at least, it is commonly photographed (see here). Locals call it a “harvester ant”. I have not seen any photographs where the ants are visible enough to identify.

The internet has two different ideas about the identity of this mystery mini-architect. One is Pheidole sykesii, which is possible, but I fear that idea may be one of those self-reinforcing internet citation circles with no verified literature behind it. The other is that this is a species of Trichomyrmex, a suggestion on twitter from several others, including at least one professional myrmecologist.

My Google-Fu has run dry, though. Do any of you know what makes these lovely mounds?

***Updates from facebook: Himender Bharti, an Indian myrmecologist, is sending students out to collect specimens. And Marek Boroweic points out older literature references to Pheidole sykesii.

***Update 2: http://www.myrmecos.net/2015/05/13/what-are-indian-harvester-ants/comment-page-1/#comment-185700

 

Answer to the Monday Mystery: Camponotus depressus

by
ads

Camponotus depressus. Image courtesy April Nobile/antweb.org, and shared under a Creative Commons CC-BY-SA 3.0 license. 

What was the oddly flat ant?

KMS picked up all ten points for naming Camponotus depressus, a bamboo-nesting species found in Amazonia south to Paraguay. Little research has been done on this unusual species. But, check out Davidson et al 2006:

Davidson, W.; Arias, Ja; Mann, J., 2006: An experimental study of bamboo ants in western Amazonia. Insectes Sociaux ruary; 53(1): 108-114

 

 

Here’s Looking At You, Ant

by

eye

The compound eye of many ants, including a Camponotus I imaged this morning on the new focus-stacking rig, has two colors of ommatidia. Most are black, but the peripheral facets are lighter. I’ve seen this for years but had no idea why this might be the case.

A quick search on Google scholar suggests an orientation function related to light polarization:

abstract

Can anyone who knows more about insect vision than me weigh in? I’m genuinely curious.

 

Camponotus sayi

Camponotus sayi, worker from Austin, Texas.

 

Update: Micheal Bok has the answer!

Monday Night Mystery: An Eye For Ant Genetics

by

Here are four fragments of mitochondrial DNA:

1. GGATTAATTGGATCCTCTATGAGTATAATTATCCGATTAGAACTAGGCTCATG
2. ATCATCAATAAGAATAATTATTCGAATTGAATTAGGATCCTGTGGATCCATTA
3. TATAAGATTTTGACTCTTACCACCTTCCATTACTCTTTTACTTTTAAGAAATTT
4. TCAATAAGAATATTAATTCGTTTAGAACTAGGAACATGTAATTCCATTATCAAT

And here are the eyes of four ants:

mystery100

To win all 10 points for tonight’s mystery, be the first to correctly pair each sequence with its eye.

The cumulative points winner across all mysteries for the month of February will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!