Answer to the Monday Mystery

by
ac

Cimex lectularius, the common bedbug, getting a taste of me.

 

What were those grapelike globules? All ten points go to Guillaume D for his guess of a bed bug’s compound eye. Guillaume accumulated enough points earlier in the month to lock in a win for February. Congrats, Guillaume, email me for your loot!

The SEM image in the mystery post was taken from the CDC public domain image library, a great source of open images for blogging and teaching.

 

Here’s Looking At You, Ant

by

eye

The compound eye of many ants, including a Camponotus I imaged this morning on the new focus-stacking rig, has two colors of ommatidia. Most are black, but the peripheral facets are lighter. I’ve seen this for years but had no idea why this might be the case.

A quick search on Google scholar suggests an orientation function related to light polarization:

abstract

Can anyone who knows more about insect vision than me weigh in? I’m genuinely curious.

 

Camponotus sayi

Camponotus sayi, worker from Austin, Texas.

 

Update: Micheal Bok has the answer!

Monday Night Mystery: The Grapes Of Wrath

by
mystery15

public domain image

 

Tonight’s challenge is a bunch of grapes something small scanned in an electron microscope. To win points, be the first to answer the following questions correctly.

1. What is the bubbly structure at the center of the image? (2 points)
2. What is the mystery animal’s genus & species? (6 points)
3. Where are you most likely to find this animal? (2 points)
A. Chicago
B. The Amazon
C. The Everglades
D. Death Valley

The cumulative points winner across all mysteries for the month of February will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

 

Answer to the Monday Mystery

by
Pseudomyrmex gracilis 4

Pseudomyrmex gracilis, Archbold Biological Station, Florida

 

What was the correct sequence/species match?

1 – D; Wasmannia auropunctata
2 – C; Pseudomyrmex gracilis
3 – A; Formica moki
4 – B; Proceratium avium

Points are split 5 each between Sean McCann, who was first to correctly guess two of the answers, and Tonya Severson, who got them all correct. Nice work. This was one of the more difficult challenges.

 

Monday Night Mystery: An Eye For Ant Genetics

by

Here are four fragments of mitochondrial DNA:

1. GGATTAATTGGATCCTCTATGAGTATAATTATCCGATTAGAACTAGGCTCATG
2. ATCATCAATAAGAATAATTATTCGAATTGAATTAGGATCCTGTGGATCCATTA
3. TATAAGATTTTGACTCTTACCACCTTCCATTACTCTTTTACTTTTAAGAAATTT
4. TCAATAAGAATATTAATTCGTTTAGAACTAGGAACATGTAATTCCATTATCAAT

And here are the eyes of four ants:

mystery100

To win all 10 points for tonight’s mystery, be the first to correctly pair each sequence with its eye.

The cumulative points winner across all mysteries for the month of February will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

Answers to the Monday Mysteries

by
Papilio1

Papilio glaucus

 

I’m economizing this month by doubling up on mystery answers. Yesterday’s scaly challenge depicted the hindwing of a tiger swallowtail, Papilio glaucus, Papilionidae, and this species is least likely to be found on carrots.

6 points to Guillaume D, and 2 to MrILoveTheAnts, for being the first to correctly pick the taxonomy and the host plant questions, respectively.

For the preceding week’s Hitchhiking Conundrum, the correct answers were: Nicrophorus, the mites were Poecilochirus, the off-frame insect was a calliphorid fly whose larvae are sometimes eaten by the hitchhiking mites.

Rodolfo swept all ten points within minutes. Impressive! One consolation point goes to Ben Coulter, who found the original, uncropped image online and identified the fly as Calliphora.

 

Nicrophorus1

 

 

 

 

Monday Night Mystery: The Scales of Just This

by

mystery12

These colorful scales belong to a common North American insect. Your mission, should you choose to accept it, is to answer the following:

1. What part of the insect is shown? (2 points)
2. To what family (1 point), genus (2 points), and species (3 points) does this insect belong?
3. Which of the following plants is least likely to host the immature form of this insect? Carrot, Tulip Tree, Oak Tree, Black Cherry, Magnolia (2 points).

The cumulative points winner across all mysteries for the month of February will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

 

BugShot 2015 Photography Workshop Schedule

by

BelizeBeetle

 

I am very, very pleased to announce this year’s insect photography workshops! Based on popular demand, BugShot visits the west coast for the first time- to California’s lovely Hastings Natural History Reservation- while our annual Belize adventure features a new instructor, the widely-acclaimed photographer Nicky Bay. Here’s the schedule:

May 7-10 – BugShot 2015 – Hastings Natural History Reservation, California – [$710/770 – register online]

August 5-12 – BugShot/Belize 2015 – Ian Anderson’s Caves Branch Jungle Lodge – [preview] – [$3249/3449 – register online]

These workshops are a highlight of my year. We spend time in beautiful natural areas exchanging photography and entomology tips, but the best part is the happy community that has sprung up around our workshops. If you haven’t been yet, you should try to this year. We’d love to have you.