Monday Night Mystery: An Eye For Ant Genetics

Spread the love

Here are four fragments of mitochondrial DNA:

1. GGATTAATTGGATCCTCTATGAGTATAATTATCCGATTAGAACTAGGCTCATG
2. ATCATCAATAAGAATAATTATTCGAATTGAATTAGGATCCTGTGGATCCATTA
3. TATAAGATTTTGACTCTTACCACCTTCCATTACTCTTTTACTTTTAAGAAATTT
4. TCAATAAGAATATTAATTCGTTTAGAACTAGGAACATGTAATTCCATTATCAAT

And here are the eyes of four ants:

mystery100

To win all 10 points for tonight’s mystery, be the first to correctly pair each sequence with its eye.

The cumulative points winner across all mysteries for the month of February will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

5 thoughts on “Monday Night Mystery: An Eye For Ant Genetics”

  1. Pingback: – Answer to the Monday Mystery

  2. Andrés Sánchez

    1: D – Wasmannia auropunctata
    2: C – Pseudomyrmex gracilis
    3: A – Formica moki
    4: B – Proceratium avium

Leave a Reply