Here’s a challenge to test your molecular and your morphological mettle:
GAAGAGACATTTGAAGATTTAGGAGAGGA
CATTAACAATCACATAGAGTTATTGAAGTG
Myrmecos points will be awarded for the first correct answers to the following questions:
1. Which of the following animals is the most likely source for this sequence? (6 points)
2. Although our mystery sequence was isolated from one of these animals, a more ancient source for the sequence comes from a quite different group of organisms. What are they? (4 points)
The cumulative points winner across all mysteries for the month of August will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.
Good luck, and… um, have a blast!
16 comments on Monday Night Mystery: Match the Mystery DNA
1) Aphis nerii, picture A.
2) from a fungus (details coming shortly).
“The carotene desaturase was acquired from a fungal species outside of Ascomycota or Basidiomycota and closest to Mucoromycotina among sequences available in databases.” http://www.researchgate.net/publication/51606481_Diversification_of_genes_for_carotenoid_biosynthesis_in_aphids_following_an_ancient_transfer_from_a_fungus
I am going to guess A, since I think it is the pea aphid which has been fully sequenced. D seems quite possible too since I think that is the green peach aphid and there is a great deal of genetic and genomic work on that as well. I’ll stick with A as my guess though.
Oh right, the second question further supports my guess for A because it has been shown that the gene in the pea aphid for carotenoid production is thought to have come by horizontal gene transfer from a fungus.
Guess B based on Aphis nerii google image result. They are mostly yellow in color.
I agree, B is a better fit, I can’t believe I wrote A… I tried to go too fast.
Aphis nerii, image B.
copy B carotenoid desaturase gene, partial.
origin is fungal (protein seems to be widespread in that taxon)
structure of the protein is quite like the pdb identifier 4dgk
I am going to pick image D only because it matches a post from 11/26/12 with the same DNA sequence with the same pea aphid photo. My guess is totally uneducated and based only on what I have read from other posts.
Other than someone who holds a Ph.D in entomology, it is hard for me to imagine who else might reasonably be expected to be able to decipher these sequences.
I have such a Ph. D. and can’t answer it without some research on the internet, Scott. But probably any whiz-kid undergrad biology student could, especially one with an interst in molecular evolution anad such.
I do know how to spell interest & and!
Deciphering the DNA is not quite so arcane as you think. Most Bio students these days learn about BLAST- which is essentially a reverse-search engine open for anyone to use: http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome
The DNA part is just a plug and chug. The tricky part, and the part that took this week’s guessers the longest time to solve, is the old-fashioned ability to recognize what a species looks like from a picture. That they don’t teach anymore, alas.
Very nice. Of course there had to be a reason for you to end your post the way you did. Have a blast, indeed!
Very true, I know this won’t win me points, but I was thinking B because of the yellow, and the hairy leaf closer to Asclepias, still wrote A in my haste…
Pingback: Answer to last week’s mystery: Aphis nerii – MYRMECOS - Insect Photography - Insect Pictures