Monday Night Mystery: Match the Mystery DNA

Here’s a challenge to test your molecular and your morphological mettle:

GAAGAGACATTTGAAGATTTAGGAGAGGA
CATTAACAATCACATAGAGTTATTGAAGTG

Myrmecos points will be awarded for the first correct answers to the following questions:

1. Which of the following animals is the most likely source for this sequence? (6 points)

mystery

2. Although our mystery sequence was isolated from one of these animals, a more ancient source for the sequence comes from a quite different group of organisms. What are they? (4 points)

The cumulative points winner across all mysteries for the month of August will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck, and… um, have a blast!

16 thoughts on “Monday Night Mystery: Match the Mystery DNA”

  1. I am going to guess A, since I think it is the pea aphid which has been fully sequenced. D seems quite possible too since I think that is the green peach aphid and there is a great deal of genetic and genomic work on that as well. I’ll stick with A as my guess though.

  2. Oh right, the second question further supports my guess for A because it has been shown that the gene in the pea aphid for carotenoid production is thought to have come by horizontal gene transfer from a fungus.

  3. Aphis nerii, image B.
    copy B carotenoid desaturase gene, partial.

    origin is fungal (protein seems to be widespread in that taxon)

    structure of the protein is quite like the pdb identifier 4dgk

  4. I am going to pick image D only because it matches a post from 11/26/12 with the same DNA sequence with the same pea aphid photo. My guess is totally uneducated and based only on what I have read from other posts.

  5. Other than someone who holds a Ph.D in entomology, it is hard for me to imagine who else might reasonably be expected to be able to decipher these sequences.

    1. James C. Trager

      I have such a Ph. D. and can’t answer it without some research on the internet, Scott. But probably any whiz-kid undergrad biology student could, especially one with an interst in molecular evolution anad such.

    2. Deciphering the DNA is not quite so arcane as you think. Most Bio students these days learn about BLAST- which is essentially a reverse-search engine open for anyone to use: http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome

      The DNA part is just a plug and chug. The tricky part, and the part that took this week’s guessers the longest time to solve, is the old-fashioned ability to recognize what a species looks like from a picture. That they don’t teach anymore, alas.

      1. Very true, I know this won’t win me points, but I was thinking B because of the yellow, and the hairy leaf closer to Asclepias, still wrote A in my haste…

  6. Pingback: Answer to last week’s mystery: Aphis nerii – MYRMECOS - Insect Photography - Insect Pictures

Leave a Reply