Monday Night Mystery: A Symbiont Scramble

Spread the love

Tonight’s challenge requires both molecular genetic skills and taxonomic acumen. Below are DNA sequences isolated from microbial associates of various insects. One of the pairs is not correct. Which is the odd pair out?

1. TCCATCGATGTGCATAACTATTTGAATAGCTTGATTAG
ATAATTCAGTAGAGGGAGATTGTCCTGTT


2. ACAGATTGTCTGATGAAATAGCGCGTCAAGCCAATCT
AAGATTGACTAAAGAGCTTGAAGTCCCCTTC

 


3. GTGTACATCCTGGGCAAGGACGAGGGCGGCCGTCACACCCC
GTTCTTCAACAACTACCGTCCGCAGTTC

 


4. TGGGAGAGAAACGAAAGCGAAGGCAAATACCCAAAGGG
TTTCTGTCGATCAAGGGCGAGAGTAGGGGG


I will award 10 Myrmecos points to the first person to correctly pick the erroneous association. Answers must be accompanied by supporting details (such as the correct insect or microbial species) for full credit.

The cumulative points winner for the month of November will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

10 thoughts on “Monday Night Mystery: A Symbiont Scramble”

  1. 1) Is Blochmannia floridanus BX248583 host is Camponotus floridanus. Looks good.
    2) Is Glycaspis brimblecombei in scales.
    3) Is Pseudonocardia alni in the symbiotic association between fungus-growing ants and protective Pseudonocardia bacteria, sounds good.
    4) Is Trichonympha sp. with termites.

    Odd one out is 2… because those are aphids not scales.

  2. It’s the second. Arsenophonus endosymbiont — usually associated with scale insects, not aphids. The first endosymbiont is a Blochmannia correctly associated with Camponotus, the third a Pseudonocardia correctly associated with leafcutter ants, and the fourth a Trichonympha correctly associated with termites.

  3. Julie and Chris are correct. The endosymbiont is Arsenophonus, in my haste to answer quickly I put the host’s name: Glycaspis brimblecombei.

  4. From a totally uneducated perspective… I think it is #3 since it looks mean enough to scare the pair into being wrong. Consider it the Chuck Norris of the ant world.

  5. Pingback: Answer to the Monday Mystery – MYRMECOS - Insect Photography - Insect Pictures

Leave a Reply