Tonight’s challenge requires both molecular genetic skills and taxonomic acumen. Below are DNA sequences isolated from microbial associates of various insects. One of the pairs is not correct. Which is the odd pair out?

1. TCCATCGATGTGCATAACTATTTGAATAGCTTGATTAG
ATAATTCAGTAGAGGGAGATTGTCCTGTT


2. ACAGATTGTCTGATGAAATAGCGCGTCAAGCCAATCT
AAGATTGACTAAAGAGCTTGAAGTCCCCTTC

 


3. GTGTACATCCTGGGCAAGGACGAGGGCGGCCGTCACACCCC
GTTCTTCAACAACTACCGTCCGCAGTTC

 


4. TGGGAGAGAAACGAAAGCGAAGGCAAATACCCAAAGGG
TTTCTGTCGATCAAGGGCGAGAGTAGGGGG


I will award 10 Myrmecos points to the first person to correctly pick the erroneous association. Answers must be accompanied by supporting details (such as the correct insect or microbial species) for full credit.

The cumulative points winner for the month of November will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!