Monday Night Mystery

Here’s a snippet of DNA sequence from a mystery insect:

ATACATGACTATTTTCTCTTCAAGATTCTAATTCACCTACGTATGATTTAATA
ATTTTTTTCCATGATTTTGCTATAATTATTTTAACTTTTATTACAATCTTAATT
TTATTTATTACACTTAGATTAATATCTAATCAATTTATTCACCGATTTTTATT
AGAAAACCAAACAATTGAAATTGTATGAACTGTCCTTCCTATGTTTATCCTC
ATTTCTATGGCTATCCCCTCAATTAAAGTACTTTATCTTACTGATGAAATTTT
TAATGTTAACCTTACTGTTAAGGCTCTTGGTCACCAATGATACTGACTTTT

This DNA is interesting because, although it has recognizable structure, it is not a gene.

I will award 8 Myrmecos points to the first person who can explain- with reference to particular features of the sequence- how I know this. Plus, 2 points to the first person to name the species.

The cumulative points winner for the month of November will take home their choice of 1) any 8×10-sized print from my photo galleries, or 2) a guest post here on Myrmecos.

Good luck!

*image by ynse reproduced under a CC-BY 2.0 license

14 thoughts on “Monday Night Mystery”

  1. I think this is a pseudogene (maybe of cytochrome oxidase I?). Though it aligns with a known gene, it looks like it has a premature stop codon (TAA) and so won’t encode a functional gene…

  2. Pseudogene (numt) from A. cephalotes – a tRNA gene translocated to the nucleus. Pseudogenes often have premature stop codons or other sequence anomalies that one wouldn’t expect in a functional gene — mutations tend to build up in them since there’s no obvious selection pressure to repair or eliminate them.

    1. “Pseudogenes often have premature stop codons or other sequence anomalies that one wouldn’t expect in a functional gene — mutations tend to build up in them since there’s no obvious selection pressure to repair or eliminate them.”

      Or at least ‘functions’ that we don’t know about yet, lol. And mutations that don’t YET have selection pressure, heh. I am convinced that genetics is weirder than we know judging on the weird we DO know about !

      1. Don’t know how true this is but I’ve read that pseudogenes can have RNAi function–so some are transcribed and negatively regulate other mRNA transcripts.

  3. too many stop codons, indeed!

    5’3′ Frame 1
    I H D Y F L F K I L I H L R Met I Stop Stop F F S Met I L L Stop L F Stop L L L Q S Stop F Y L L H L D Stop Y L I N L F T D F Y Stop K T K Q L K L Y E L S F L C L S S F L W L S P Q L K Y F I L L Met K F L Met L T L L L R L L V T N D T D F

    5’3′ Frame 2
    Y Met T I F S S R F Stop F T Y V Stop F N N F F P Stop F C Y N Y F N F Y Y N L N F I Y Y T Stop I N I Stop S I Y S P I F I R K P N N Stop N C Met N C P S Y V Y P H F Y G Y P L N Stop S T L S Y Stop Stop N F Stop C Stop P Y C Stop G S W S P Met I L T F

    5’3′ Frame 3
    T Stop L F S L Q D S N S P T Y D L I I F F H D F A I I I L T F I T I L I L F I T L R L I S N Q F I H R F L L E N Q T I E I V Stop T V L P Met F I L I S Met A I P S I K V L Y L T D E I F N V N L T V K A L G H Q Stop Y Stop L

    3’5′ Frame 1
    K S Q Y H W Stop P R A L T V R L T L K I S S V R Stop S T L I E G I A I E Met R I N I G R T V H T I S I V W F S N K N R Stop I N Stop L D I N L S V I N K I K I V I K V K I I I A K S W K K I I K S Y V G E L E S Stop R E N S H V

    3’5′ Frame 2
    K V S I I G D Q E P Stop Q Stop G Stop H Stop K F H Q Stop D K V L Stop L R G Stop P Stop K Stop G Stop T Stop E G Q F I Q F Q L F G F L I K I G E Stop I D Stop I L I Stop V Stop Stop I K L R L Stop Stop K L K Stop L Stop Q N H G K K L L N H T Stop V N Stop N L E E K I V Met Y

    3’5′ Frame 3
    K S V S L V T K S L N S K V N I K N F I S K I K Y F N Stop G D S H R N E D K H R K D S S Y N F N C L V F Stop Stop K S V N K L I R Y Stop S K C N K Stop N Stop D C N K S Stop N N Y S K I Met E K N Y Stop I I R R Stop I R I L K R K Stop S C

  4. Pingback: Belated Answer to the Monday Mystery – MYRMECOS - Insect Photography - Insect Pictures

  5. Not to nit-pick too much but stop-codons do not in themselves make a pseudo-gene. Plenty of genes are not translated and are functional non-coding RNAs such as a tRNA like the one that ended up in this protein coding gene. These functional RNAs may contain plenty of stop-codons and still be functional.

Leave a Reply