Monday Night Mystery

Let’s take a break from the photographs for a different sort of challenge. Here is a snippet of insect DNA:

TTGCTCAACTCGGTCAAAGCAAGGAAAATAAGGATGCTGTGAAAGCCGATATCGAGAAGTGC

My questions are:

  1. What species did the DNA come from? (2 points)
  2. What were scientists hoping to learn by obtaining this sequence? (8 points)

The cumulative points winner for the month of May will win their choice of 1) any 8×10-sized print from my photo galleries, or 2) a guest post here on Myrmecos.

Good luck!

21 thoughts on “Monday Night Mystery”

  1. Sympatric speciation is the divergence of one species into two within one single population. I hope that’s correct.

  2. Alright, the closest match I could find was a segment of cDNA from Nasonia vitripennis. As for why someone might be interested in Nasonia, it appears to be a parasitoid of Calliphoridae & Sarcophagidae, making it a potential control for annoyance flies. It has also integrated genes from Pox genes and Wolbachia into it’s genome. On top of all this, female’s also thought to be able to control the sex ratio of it’s offspring through haploid-diploidy.

    Whether any of this is remotely accurate to that short string of DNA, I have no idea!

    (sequence blasted in GenBank, info from Wikipedia)

  3. The translated protein sequence is very close to a species of tsetse fly. So this might be from a species of Glossina. The sequence codes for an odorant binding protein which is involved with the insect olfactory system. They are thought to ferry odor molecules to olfactory receptors in neurons inside sensory hairs in organs like the antennae. There’s a bit of research on these genes in insects that vector human diseases. The thought is that if say a mosquito’s sense of smell is blocked somehow they wont be able to bite humans and vector parasites like malaria.

  4. glossina morsitans morsitans odorant protein
    Mating is blocked to reduce the population of tse tse flies

  5. Drosophila willistoni, strain TSC#14030-0811.24.

    As it was sequenced to supply a reference sequence of Drosophila species, I suppose it’s important for comparative genomics in the Drosophila genus, with particular reference to D. melanogaster. The superstar of genomics! As one of my lecturers put it: “Melanogaster rules because you can use it as a genetic system for studying everything but photosynthesis.” Made me want to create transgenic photosynthesising flies. >_>

    The identity of the gene from which you obtained that snippet, I don’t know. I’m just an undergrad this far; I don’t know my way around all the databases yet! OuO;

  6. Drosophila melanogaster; the general purpose is to get a high quality euchromatic genome of D. malanogaster.

  7. I’m with Josephine re: D. willistoni. Looks like an OBP (odorant binding protein), and a basic search suggests that proteins in this family have been used to characterize genome (or tandem genes in gene families) duplications in Drosophila (willistoni has had many such duplications). Also, duplications in OBP families in particular are important for Drosophila because it is conceivable that speciation and ecological niche-filling in this genus coincides with the acquisition of new olfactory functions.
    Or at least that’s my guess.

    1. Oops. Messor decipiens, obviously. Didn’t see that you wanted the exact species of the SimAnts.

  8. Michael Suttkus, II

    Clearly, the purpose of this sequence is to find a way to get grant funding with a random letter generator.

  9. Pingback: Belated Answer to the Monday Night Mystery – MYRMECOS - Insect Photography - Insect Pictures

Leave a Reply