Tonight we head back down to the level of molecular sequence:

GGGATCGACAGGGGCTGCCGAATTTGAGGCCCGAA
ATTCCCTACGGCAATCTACGCATTCTAGCCCAAAA

The challenge:

1. What species donated this sequence? (4 points)

2. What gene is it? (3 points)

3. Why are scientists interested in this gene, in this species? (3 points)

The cumulative points winner for the month of October will win their choice of 1) any 8×10-sized print from my photo galleries, or 2) a guest post here at Myrmecos on a safe-for-work topic of their choosing.