Monday Night Mystery

For tonight’s challenge we delve into molecular genetics. Here’s a snippet of insect DNA:

ATGAAACGAAATACATCAAGTCATTCGCATCGCGA
TGAGAGATTTAGACAATCACGCAGTGAAGATAGTG

The questions:

1. What species did this come from? (4 points)
2. What happens to an individual whose maternal and paternal chromosomes hold this same allele? (6 points)

As usual, the cumulative points winner for the month of August will win their choice of 1) any 8×10-sized print from my photo galleries, or 2) a guest post here at Myrmecos on a safe-for-work topic of their choosing.

10 thoughts on “Monday Night Mystery”

  1. FormicidaeFantasy

    A. mellifera and A. cerana apparently also have this gene. Sorry for the multiple postings, I thought I had enough information after the second post!

  2. Dang, Alex, you post a question that’s directly related to my Ph.D. dissertation, and of course I check your site too late to answer first! 🙂

    (Agreed — well done, F^F!)

  3. Pingback: Answer to the Monday Night Mystery – MYRMECOS - Insect Photography - Insect Pictures

Leave a Reply