Monday Night Mystery

from wikimedia commonsIn a change of pace, tonight’s mystery is for the bioinformaticians. Here’s some DNA sequence:

ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCT
GTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA

What sort of organism did it come from?

Ten points to the first person who can pick the genus.

20 thoughts on “Monday Night Mystery”

  1. Jerusalem artichoke? (Helianthus tuberosus)
    Yellow Perch? (Perca flavescens)
    Florida lancelet? (Branchiostoma floridae)

    I’m going to go with the ‘choke.

  2. Julie Stahlhut

    I was way too late to be first here. Do I get a point for being first to nail it on Facebook? πŸ™‚

  3. Pingback: Answer to the Monday Night Mystery « Myrmecos Blog

Leave a Reply