In a change of pace, tonight’s mystery is for the bioinformaticians. Here’s some DNA sequence:
ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCT
GTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA
What sort of organism did it come from?
Ten points to the first person who can pick the genus.
Oh, I can do this one. BLAST against nr says Plega!
random guess: Acyrthosiphon???
I second Aaron, Plega dactylota – a mantispid.
Jerusalem artichoke? (Helianthus tuberosus)
Yellow Perch? (Perca flavescens)
Florida lancelet? (Branchiostoma floridae)
I’m going to go with the ‘choke.
Oh yeah, this is an insect blog. So, one might suspect the mantispid – a totally rad beast!
Camponotus! π
Drosophila??? Phlebotomus????? Rhodnius?????? Anopheles? Apis? oh, I don’t know.
one more wild guess: Solenopsis? Linepithema?
You know, if you just cut and paste every animal genus name you’re bound to hit it at some point. π
Genbank has a 100% match to the CAD gene of a Mantidfly called Plega dactylota
How do you use Genbank? I don’t really understand it.
I was way too late to be first here. Do I get a point for being first to nail it on Facebook? π
Ah, now I’ve finally found it.
Finally one I could get and I’m too late. Genbank says Plega dactylota.
I would’ve so totally gotten this one if I’d gotten here earlier π
that’s funny π
Plega (Mantispidae)
Aw, I’m not first by a long shot.
Pingback: Answer to the Monday Night Mystery « Myrmecos Blog
I Blasted it on GeneBank. Came out it belongs to me….go figure….
BLAST recons it as Plega!!!